mt K1a1 in Italy


Posts: 3152
Joined: Sun Mar 18, 2012 7:08 am
Location: Pisa (Italy)
YDNA:
R- Z2110 (KV7Y2)
MtDNA:
K1a1b1e/HQ176413
PostPosted: Fri Nov 02, 2018 9:57 am
aDNA mt sample
396 I4936
BBC Copper Age Italy F -2500 -1900 K1a bam 2.96626 FASTA |

73G 471C 497T 750G 2706G 9055A 9698C 11299C 11719A 12308G 12372A 15326G 16093C

is very likely an K1a1 linked to this modern haplotype for the mutation T471C:
EU259093 FTDNA Haplogroup [K1a1] 10-NOV-2007
A73G A263G 315.1C T471C C497T A750G T1189C A1438G A1811G A2706G A3480G A4769G T6620C C7028T A8860G G9055A T9698C A10398G A10550G T11299C A11467G G11719A G11914A A12308G A12358G G12372A C14167T C14766T T14798C A15326G T16224C T16311C T16519C
CRS A263G A750G A1438G A2706G A4769G C7028T A8860T C14766T A15326G

R0 A73G G11719A
U A11467G A12308G G12372A
U2'3'4'7'8'9 A1811G
U8 T9698C
U8b'K G9055A C14167T
K A3480G A10550G T11299C T14798C T16224C T16311C
K1 T1189C A10398G
K1a C497T
K1a1 G11914A

Of course G11914A isn’t tested:
CTCAACATACTAGTNNNNNCNNNNNNCTCCCTCTACATATTTACCACAAC
ACAATGGGGCTCACTCANNNNNCNCATTAACAANNNNNNACCCTNNNNNN
NNNGAGAAAACACCCTCATGTTCATACACCTATCCCCCATNNNNNNNNNN
[11901]NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
[11951]NNNNNNNNNNNNNNNNNNTGAATCTGACAACAGNGGCTTACGACCCCTTA
[12201]TTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCCCATGTCTAAC

Mt Haplogroup K1a1 is overwhelmingly present in Italy.

Posts: 3152
Joined: Sun Mar 18, 2012 7:08 am
Location: Pisa (Italy)
YDNA:
R- Z2110 (KV7Y2)
MtDNA:
K1a1b1e/HQ176413
PostPosted: Fri Nov 02, 2018 10:59 am
EU259093 FTDNA Haplogroup [K1a1] 10-NOV-2007
A73G A263G 315.1C T471C C497T A750G T1189C A1438G A1811G A2706G A3480G A4769G T6620C C7028T A8860G G9055A T9698C A10398G A10550G T11299C A11467G G11719A G11914A A12308G A12358G G12372A C14167T C14766T T14798C A15326G T16224C T16311C T16519C

JQ705773 Behar Haplogroup [K1a1] 07-APR-2012
A73G C114T A263G 315.1C C497T A750G T1189C A1438G A1811G A2706G A3480G A4769G A6929G C7028T A8860G G9055A T9698C A10398G A10550G T11299C A11467G C11471T G11719A G11914A C12085T A12308G G12372A C14167T C14766T T14798C A15326G T16224C T16311C T16519C

JX273286(Ashkenazi) Costa Haplogroup [K1a1] 27-SEP-2013
A73G C114T A263G 315.1C C497T A750G T1189C A1438G A1811G A2706G C3107N A3480G G4048A A4769G C7028T C7462T C7699T A8860G G9055A T9698C A10398G A10550G A11084G T11299C A11467G G11719A G11914A A12308G G12372A A12597G C13578T C14167T C14766T T14798C A15326G A15340G T16224C T16311C T16519C

Of these three K1a1 the first we have seen above is linked with an Italian sample of 4500 years ago just for the mutation T471C. The second is said from Italy. The third is said from Russia, but it belongs to an Ashkenazi Jew. The same sample, or a linked one, is submitted also under the ID KM052375, and, strangely, twice in the Ian Logan spreadsheet. With its 7 mutation (G4048A C7462T C7699T A11084G A12597G C13578T A15340G), not counting C114T it has in common with JQ705773, it seems coming from some strange region and anyway separated from the beginning from the Italian samples.

The aDNA I4936 hasn’t the mutation of EU259093 in T6620C:
6601 acctattctg atttttcggt caccctgaag tttatattct tatcctacca ggcttcggaa
6601 ACCTATTCTG ATTTTTCGGT CACCCTGAAG TTTATATTCT TATCCTACCA
thus this mutation happened in these 4500 years.

Return to Haplogroup K (mtDNA)

Who is online

Users browsing this forum: No registered users and 1 guest